ascR [2019-06-19 12:42:08]

alkyl-sulphur catabolism regulator, transcriptional activator of the snaA-tcyJ-tcyK-tcyL-tcyM-tcyN-cmoO-cmoI-cmoJ-ribR-sndA-ytnM operon

Locus: BSU29400

Isoelectric point: 6.23

Molecular weight: 35.08 kDa

Protein length: 308 aa

Gene length: 927 bp

Function: regulation of sulphur metabolism

Product: alkyl-sulphur catabolism regulator, transcriptional activator (LysR family)

Essential: no

Synonyms: ytlI

Genomic Context

Loading

Categories containing this gene/protein

• Metabolism → Amino acid/ nitrogen metabolism → Biosynthesis/ acquisition of amino acids → Biosynthesis/ acquisition of cysteine
• Metabolism → Additional metabolic pathways → Sulfur metabolism → Conversion of S-methyl cysteine to cysteine
• Information processing → Regulation of gene expression → Transcription factors and their control → Transcription factors/ other

Gene

Coordinates: 3,008,938 3,009,864

The protein

Protein family

• LysR family

Expression and Regulation

Operons

• Genes: ascR
  Description: PubMed

  Sigma factors

  • SigA: sigma factor, PubMed, in SigA regulon

  Regulatory mechanism

  • CymR: repression, PubMed, in CymR regulon

  Regulation

  • repressed in the presence of cysteine (CymR) PubMed

Biological materials

Mutant

• MGNA-A169 (ytlI::erm), available at the NBRP B. subtilis, Japan
• BKE29400 (ascR::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CAATGTGCTCCCTCCTGTTT, downstream forward: _UP4_TAACTGAAAAAATAAAAACC
• BKK29400 (ascR::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CAATGTGCTCCCTCCTGTTT, downstream forward: _UP4_TAACTGAAAAAATAAAAACC

References

Loading